DH10B E. coli aptI/gidB::Landing Pad
(Bacterial strain #83036)

• Purpose: For site-specific chromosomal insertion of a target DNA sequence at an engineered landing pad site in the atpI/gidB locus.
• Depositing Lab: Cammie Lesser
• Publication: Reeves et al ACS Synth Biol. 2015 May 15;4(5):644-54. doi: 10.1021/acssynbio.5b00002. Epub 2015 Apr 24.

Backbone

• Vector backbone: none

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B E. coli aptI/gidB::Landing Pad
• Growth instructions: Tetracycline 12.5 ug/ml
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: none
• Promoter: none

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: atpI/gidB F: CAGTAACTGAACGAGCAGAAG
• 3′ sequencing primer: atpI/gidB R: CTTCGTCAGGTGCAACATGAGC

Resource Information

• Supplemental Documents:
  • PCR primer information for strain verification
  • Verification of Bacterial strain #83036
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Precursor strain: ElectroMAX DH10B E. coli cells

Landing pad cassette at at the aptI/gidB locus includes in this order: I-SceI restriction site - Landing Pad 1 (LP1) sequence - tetA gene - Landing Pad 2 (LP2) sequence - I-SceI restriction site.

This strain was made based on the technology described in the Kulman and Cox 2010 Nucleic Acids Res. paper: Site-specific chromosomal integration of large synthetic constructs. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2847246/