Osa-pCAMBIA-1301-STTM159
(Plasmid #84195)

• Purpose: Disturb the expression of miR159 in rice
• Depositing Lab: Guiliang Tang
• Publication: Yan et al Plant Cell. 2012 Feb;24(2):415-27. doi: 10.1105/tpc.111.094144. Epub 2012 Feb 17.

Backbone

• Vector backbone: pCAMBIA-1301
• Backbone manufacturer: CAMBIA Company
• Backbone size w/o insert (bp): 11827
• Vector type: Bacterial Expression, Yeast Expression, Plant Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: miR159
• Alt name: Osa-miR159
• Species: Rice
• Insert Size (bp): 2846
• GenBank ID: miRBase (MI0001092-MI0001097)
• Promoter: 2x35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: 35S promoter
• 3′ sequencing primer: AGGTTTAGTCGTCTCGTGTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid used to disturb miR159’s expression by STTM method invented by Dr. Guiliang Tang’s Lab in Michigan Technological University (Plant cell, 2012), Houghton, MI, USA. The method used to construct this plasmid refers to Tang et al., (Methods, 2012) with minor revision. The STTM sequence in this plasmid may contain discrepancies compared to the reference sequence(s). According to the depositing lab, these mutations should not affect plasmid function. For additional published information regarding this plasmid, please see https://www.cell.com/molecular-plant/pdf/S1674-2052(18)30275-2.pdf?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1674205218302752%3Fshowall%3Dtrue#