Skip to main content

pSLQ2842 pPB: CAG-GID1-VPR-IRES-Zeo-WPRE PGK-GAI-tagBFP-SadCas9
(Plasmid #84244)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84244 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 84244-D50 50 μg of DNA in Tris buffer $495
DNA 84244-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PB
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 13933
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GAI-tagBFP-Sa dCas9
  • Alt name
    nuclease dead SauCas9
  • Species
    A. thaliana (mustard weed), Synthetic; S. aureus
  • Insert Size (bp)
    4275
  • Mutation
    D10A, N580A
  • Promoter PGK
  • Tags / Fusion Proteins
    • GAI-tagBFP-Nucleoplasmin NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gaaggtcctccggaggcc
  • 3′ sequencing primer CGGTCTGTATATCGAGGTTTATTTATTAATTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GID1-VPR
  • Alt name
    VP64-p65-Rta
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2631
  • Mutation
    Synonymous mutation in PYL1 to remove XhoI site
  • Promoter CAG
  • Tags / Fusion Proteins
    • GID1 (N terminal on insert)
    • IRES-Zeocin (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tcggcttctggcgtgtga
  • 3′ sequencing primer gacggcaatatggtggaaaataac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Sa dCas9 gene was a gift from Feng Zhang (MIT). The GAI and GID1 domains were gifts from Takanari Inoue (Johns Hopkins)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2842 pPB: CAG-GID1-VPR-IRES-Zeo-WPRE PGK-GAI-tagBFP-SadCas9 was a gift from Stanley Qi (Addgene plasmid # 84244 ; http://n2t.net/addgene:84244 ; RRID:Addgene_84244)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111