pGEX4T-Mst2 SARAH
(Plasmid #84298)

• Purpose: Expresses Mst2 SARAH domain for interaction and spectroscopy studies.
• Depositing Lab: Jonathan Chernoff
• Publication: Rawat et al Curr Biol. 2016 Jun 20;26(12):1556-63. doi: 10.1016/j.cub.2016.04.027. Epub 2016 May 26.

Backbone

• Vector backbone: pGEX-4T
• Backbone manufacturer: GE Healthcare
• Backbone size w/o insert (bp): 4969
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Mst2
• Alt name: Stk3
• Species: H. sapiens (human)
• Insert Size (bp): 162
• Mutation: L443W
• Entrez Gene: STK3 (a.k.a. KRS1, MST2)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To produce SARAH domain for interaction studies. Has a Trp residue for spectroscopy studies