B2M Bulldozer (gRNA crB2M_13)
(Plasmid
#84381)
-
PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cells
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneModified TOPO
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB2M Bulldozer crB2M_13 gRNA
-
gRNA/shRNA sequenceGCTACTCTCTCTTTCTGGCC
-
SpeciesH. sapiens (human)
- Promoter hU6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer T7
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B2M Bulldozer (gRNA crB2M_13) was a gift from Chad Cowan (Addgene plasmid # 84381 ; http://n2t.net/addgene:84381 ; RRID:Addgene_84381) -
For your References section:
Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Mandal PK, Ferreira LM, Collins R, Meissner TB, Boutwell CL, Friesen M, Vrbanac V, Garrison BS, Stortchevoi A, Bryder D, Musunuru K, Brand H, Tager AM, Allen TM, Talkowski ME, Rossi DJ, Cowan CA. Cell Stem Cell. 2014 Nov 6;15(5):643-52. doi: 10.1016/j.stem.2014.10.004. Epub 2014 Nov 6. 10.1016/j.stem.2014.10.004 PubMed 25517468