Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CAG-Cas9-T2A-EGFP-ires-puro
(Plasmid #78311)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78311 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PyCAG
  • Total vector size (bp) 11467
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WT SpCas9-T2A-EGFP-ires-puromycin resistance
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    7118
  • Promoter CAG
  • Tag / Fusion Protein
    • T2A-EGFP-ires-puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site NsiI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cas9 expressing vector for genome editing of human pluripotent stem cells. Transfectants can be selected by EGFP+ sorting or transient treatment with puromycin. Described in Saarimäki-Vire, Balboa et al- 2016.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-Cas9-T2A-EGFP-ires-puro was a gift from Timo Otonkoski (Addgene plasmid # 78311 ; http://n2t.net/addgene:78311 ; RRID:Addgene_78311)
  • For your References section:

    An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation. Saarimaki-Vire J, Balboa D, Russell MA, Saarikettu J, Kinnunen M, Keskitalo S, Malhi A, Valensisi C, Andrus C, Eurola S, Grym H, Ustinov J, Wartiovaara K, Hawkins RD, Silvennoinen O, Varjosalo M, Morgan NG, Otonkoski T. Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055. 10.1016/j.celrep.2017.03.055 PubMed 28402852