-
PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki
Located in Finland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePyCAG
- Total vector size (bp) 11467
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWT SpCas9-T2A-EGFP-ires-puromycin resistance
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)7118
- Promoter CAG
-
Tag
/ Fusion Protein
- T2A-EGFP-ires-puro (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site NsiI (unknown if destroyed)
- 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer M13 Reverse CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPX330, Feng Zhang lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cas9 expressing vector for genome editing of human pluripotent stem cells. Transfectants can be selected by EGFP+ sorting or transient treatment with puromycin. Described in Saarimäki-Vire, Balboa et al- 2016.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-Cas9-T2A-EGFP-ires-puro was a gift from Timo Otonkoski (Addgene plasmid # 78311 ; http://n2t.net/addgene:78311 ; RRID:Addgene_78311) -
For your References section:
An Activating STAT3 Mutation Causes Neonatal Diabetes through Premature Induction of Pancreatic Differentiation. Saarimaki-Vire J, Balboa D, Russell MA, Saarikettu J, Kinnunen M, Keskitalo S, Malhi A, Valensisi C, Andrus C, Eurola S, Grym H, Ustinov J, Wartiovaara K, Hawkins RD, Silvennoinen O, Varjosalo M, Morgan NG, Otonkoski T. Cell Rep. 2017 Apr 11;19(2):281-294. doi: 10.1016/j.celrep.2017.03.055. 10.1016/j.celrep.2017.03.055 PubMed 28402852