Skip to main content

pTriEx-RhoA-Q63L_mScarlet-i_SGFP2
(Plasmid #85072)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85072 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 85072-D50 50 μg of DNA in Tris buffer $495
DNA 85072-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTriEx
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5043
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RhoA Biosensor constitutively active (Q63L)
  • Alt name
    RHOA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2436
  • Mutation
    Q63L
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mScarlet-i and SGFP2 (N terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGTGAGCCAGGGCATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEx-RhoA-Q63L_mScarlet-i_SGFP2 was a gift from Dorus Gadella (Addgene plasmid # 85072 ; http://n2t.net/addgene:85072 ; RRID:Addgene_85072)
  • For your References section:

    mScarlet: a bright monomeric red fluorescent protein for cellular imaging. Bindels DS, Haarbosch L, van Weeren L, Postma M, Wiese KE, Mastop M, Aumonier S, Gotthard G, Royant A, Hink MA, Gadella TW Jr. Nat Methods. 2016 Nov 21. doi: 10.1038/nmeth.4074. 10.1038/nmeth.4074 PubMed 27869816