bPAC-mycHis_pGEM
(Plasmid
#85468)
-
PurposeExpression of photoactivated cyclase bPAC of Beggiatoa sp.
-
Depositing Lab
-
Depositing OrganizationHumboldt-Universitaet zu Berlin
Located in Germany -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85468-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85468-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGEM
- Backbone size w/o insert (bp) 3152
- Total vector size (bp) 4202
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacterial Photoactivated Adenylyl Cyclase
-
Alt namebPAC
-
SpeciesSynthetic; Beggiatoa sp.
-
Insert Size (bp)1050
-
GenBank IDGU461307.1
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BsiWI (unknown if destroyed)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 85468-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85468-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bPAC-mycHis_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85468 ; http://n2t.net/addgene:85468 ; RRID:Addgene_85468) -
For your References section:
Light modulation of cellular cAMP by a small bacterial photoactivated adenylyl cyclase, bPAC, of the soil bacterium Beggiatoa. Stierl M, Stumpf P, Udwari D, Gueta R, Hagedorn R, Losi A, Gartner W, Petereit L, Efetova M, Schwarzel M, Oertner TG, Nagel G, Hegemann P. J Biol Chem. 2011 Jan 14. 286(2):1181-8. 10.1074/jbc.M110.185496 PubMed 21030594