-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneYIPlac204
- Backbone size w/o insert (bp) 4000
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDsRed-Express2
-
Alt nameDsRed
-
SpeciesDiscosoma sp.
-
Insert Size (bp)4985
-
GenBank IDFJ226077
-
Tags
/ Fusion Proteins
- preKar2 (N terminal on insert)
- HDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CTACAAAAAACACATACATAAACT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Linearize with EcoRV to direct integration at the TRP1 locus.
Addgene NGS confirms a single silent mutation within the DsRed-Express2 coding sequence compared to the reference sequence provided by the depositing laboratory
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIPlac204TKC-DsRed-Express2-HDEL was a gift from Benjamin Glick (Addgene plasmid # 21770 ; http://n2t.net/addgene:21770 ; RRID:Addgene_21770)