Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

YIPlac204TKC-GFP-HDEL
(Plasmid #21771)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21771 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    YIPlac204
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Green Fluorescent Protein (GFP)
  • Alt name
    GFP
  • Alt name
    EGFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    860
  • Tags / Fusion Proteins
    • preKar2 (N terminal on insert)
    • HDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CTACAAAAAACACATACATAAACT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YIPlac204TKC-GFP-HDEL was a gift from Benjamin Glick (Addgene plasmid # 21771 ; http://n2t.net/addgene:21771 ; RRID:Addgene_21771)
  • For your References section:

    A role for actin, Cdc1p, and Myo2p in the inheritance of late Golgi elements in Saccharomyces cerevisiae. Rossanese OW, Reinke CA, Bevis BJ, Hammond AT, Sears IB, O'Connor J, Glick BS. J Cell Biol. 2001 Apr 2. 153(1):47-62. 10.1083/jcb.153.1.47 PubMed 11285273