Skip to main content

pX330-H11r2-3-DD-Cas9
(Plasmid #85980)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85980 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    modified pX330
  • Modifications to backbone
    BbsI sites in sgRNA replaced with 2 BsaI sites
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DD-SpCas9
  • gRNA/shRNA sequence
    GTGTCAGCCTCCTGATTAGC
  • Insert Size (bp)
    4599
  • Tag / Fusion Protein
    • FKBP12 L106P DD (N terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

DD domain tested for stabilization with 500 nM Shield-1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-H11r2-3-DD-Cas9 was a gift from Michele Calos (Addgene plasmid # 85980)
  • For your References section:

    In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Geisinger JM, Turan S, Hernandez S, Spector LP, Calos MP. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. 10.1093/nar/gkv1542 PubMed 26762978