Skip to main content

LVXN-Neo-NSD2-E1099K
(Plasmid #86011)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86011 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 86011-D50 50 μg of DNA in Tris buffer $495
DNA 86011-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    UTF-8'en-us'pLVX-IRES-Neo_DS_SEQ
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8316
  • Total vector size (bp) 8316
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NSD2 E1099K mutant
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4098
  • Mutation
    E1099K; K1002R (please see depositor comments below)
  • GenBank ID
    NM_001042424
  • Entrez Gene
    NSD2 (a.k.a. KMT3F, KMT3G, MMSET, RAUST, REIIBP, TRX5, WHS, WHSC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag tag  D Y K D D D D K (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer taggcgtgtacggtgggagg
  • 3′ sequencing primer aggtgtatcttatacacgt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GNF

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation K1002R was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LVXN-Neo-NSD2-E1099K was a gift from Darrin Stuart (Addgene plasmid # 86011 ; http://n2t.net/addgene:86011 ; RRID:Addgene_86011)
  • For your References section:

    Global chromatin profiling reveals NSD2 mutations in pediatric acute lymphoblastic leukemia. Jaffe JD, Wang Y, Chan HM, Zhang J, Huether R, Kryukov GV, Bhang HE, Taylor JE, Hu M, Englund NP, Yan F, Wang Z, Robert McDonald E 3rd, Wei L, Ma J, Easton J, Yu Z, deBeaumount R, Gibaja V, Venkatesan K, Schlegel R, Sellers WR, Keen N, Liu J, Caponigro G, Barretina J, Cooke VG, Mullighan C, Carr SA, Downing JR, Garraway LA, Stegmeier F. Nat Genet. 2013 Nov;45(11):1386-91. doi: 10.1038/ng.2777. Epub 2013 Sep 29. 10.1038/ng.2777 PubMed 24076604