Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LVXN-Neo-NSD2
(Plasmid #86010)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 86010 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    UTF-8'en-us'pLVX-IRES-Neo_DS_SEQ
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 8316
  • Vector type
    Bacterial Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Since this plasmid is prone to recombination, we recommend testing 2-4 colonies to ensure the full plasmid is intact.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NSD2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4098
  • Mutation
    K1002R (please see depositor comments below)
  • GenBank ID
    NM_001042424
  • Entrez Gene
    NSD2 (a.k.a. KMT3F, KMT3G, MMSET, REIIBP, TRX5, WHS, WHSC1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag tag D Y K D D D D K (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer taggcgtgtacggtgggagg
  • 3′ sequencing primer aggtgtatcttatacacgt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GNF
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please note that mutation K1002R was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LVXN-Neo-NSD2 was a gift from Darrin Stuart (Addgene plasmid # 86010 ; http://n2t.net/addgene:86010 ; RRID:Addgene_86010)
  • For your References section:

    Global chromatin profiling reveals NSD2 mutations in pediatric acute lymphoblastic leukemia. Jaffe JD, Wang Y, Chan HM, Zhang J, Huether R, Kryukov GV, Bhang HE, Taylor JE, Hu M, Englund NP, Yan F, Wang Z, Robert McDonald E 3rd, Wei L, Ma J, Easton J, Yu Z, deBeaumount R, Gibaja V, Venkatesan K, Schlegel R, Sellers WR, Keen N, Liu J, Caponigro G, Barretina J, Cooke VG, Mullighan C, Carr SA, Downing JR, Garraway LA, Stegmeier F. Nat Genet. 2013 Nov;45(11):1386-91. doi: 10.1038/ng.2777. Epub 2013 Sep 29. 10.1038/ng.2777 PubMed 24076604