LVXN-Neo-NSD2
(Plasmid #86010)

• Purpose: express wild-type NSD2 in mammalian cells
• Depositing Lab: Darrin Stuart
• Publication: Jaffe et al Nat Genet. 2013 Nov;45(11):1386-91. doi: 10.1038/ng.2777. Epub 2013 Sep 29.

Backbone

• Vector backbone: UTF-8'en-us'pLVX-IRES-Neo_DS_SEQ
• Backbone manufacturer: Clontech
• Total vector size (bp): 8316
• Vector type: Bacterial Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Since this plasmid is prone to recombination, we recommend testing 2-4 colonies to ensure the full plasmid is intact.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: NSD2
• Species: H. sapiens (human)
• Insert Size (bp): 4098
• Mutation: K1002R (please see depositor comments below)
• GenBank ID: NM_001042424
• Entrez Gene: NSD2 (a.k.a. KMT3F, KMT3G, MMSET, RAUST, REIIBP, TRX5, WHS, WHSC1)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag tag D Y K D D D D K (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: taggcgtgtacggtgggagg
• 3′ sequencing primer: aggtgtatcttatacacgt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GNF

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that mutation K1002R was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.