PP7 guide
(Plasmid
#86168)
-
PurposeExpresses S. Pyogenes guide with PP7 aptamer in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 86168-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 86168-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneSpCas9 guide
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePP7 guide
-
Insert Size (bp)881
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gactatcatatgcttaccgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 86168-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 86168-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PP7 guide was a gift from Amit Choudhary (Addgene plasmid # 86168 ; http://n2t.net/addgene:86168 ; RRID:Addgene_86168) -
For your References section:
Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801
