DHFR-PP7-VP64_T2A_GFP
(Plasmid
#86167)
-
PurposeExpresses PP7-VP64 fused to DHFR domain on N-terminus in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneplenti
- Backbone size w/o insert (bp) 9204
- Total vector size (bp) 11130
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersGFP fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDHFR-PP7-VP64_T2A_GFP
-
Insert Size (bp)1926
- Promoter EF1a
-
Tags
/ Fusion Proteins
- Destabilized domain (N-terminus version) of E.coli dihydrofolate reductase (N terminal on insert)
- T2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atttgccctttttgagtttgga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DHFR-PP7-VP64_T2A_GFP was a gift from Amit Choudhary (Addgene plasmid # 86167 ; http://n2t.net/addgene:86167 ; RRID:Addgene_86167) -
For your References section:
Multidimensional chemical control of CRISPR-Cas9. Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, Choudhary A. Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub 2016 Oct 31. 10.1038/nchembio.2224 PubMed 27820801