pSpCas9(BB)-2A-miRFP670
(Plasmid #91854)

• Purpose: Cas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988
• Depositing Lab: Ralf Kuehn
• Publication: pSpCas9(BB)-2A-miRFP670 (unpublished)

Backbone

• Vector backbone: PX459
• Backbone size w/o insert (bp): 2522
• Total vector size (bp): 8866
• Modifications to backbone: Removal of F1 promoter. Exchange of 2A-puro with 2A-miRFP670.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: hSpCas9-2A-miRFP670
• Alt name: Cas9
• Alt name: iRFP
• Species: Synthetic
• Insert Size (bp): 6300
• GenBank ID: hSpCas9-2A-miRFP670
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • 2A-miRFP670 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTTATGGCGAGGCGGCGG
• 3′ sequencing primer: CATCACTAGGGGTTCCTGCG

Gene/Insert 2

• Gene/Insert name: BB-guide RNA
• Alt name: U6-BB-gRNA
• Species: Synthetic
• Insert Size (bp): 300
• GenBank ID: U6- BbsI-gRNA
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GACAGGTATCCGGTAAGCGG
• 3′ sequencing primer: TGGAAAGTCCCTATTGGCGT

Resource Information

• Supplemental Documents:
  • spcas9-2a-mirfp670_u6-bbsgrna.gb
• A portion of this plasmid was derived from a plasmid made by: From Addgene #62988 and #79987
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is an altered version of the Zhang Lab's Addgene Plasmid #62988 Cas9-2A-Puro. The miRFP670 came from Verkhusha Lab's Addgene Plasmid #79987. The 2A sequence from the original plasmid was kept. Also, the F1 sequence was deleted.