Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40650)


Item Catalog # Description Quantity Price (USD)
Plasmid 40650 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pHAGE-UBC-RIG (modified)
  • Modifications to backbone
    see associated publication
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    tandem dimer PP7 bacteriophage coat protein (PCP)
  • Species
  • Insert Size (bp)
  • Promoter human ubiquitin C (UBC)
  • Tags / Fusion Proteins
    • NLS (N terminal on backbone)
    • HA (N terminal on backbone)
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer FUGW (5'-ATTACAGGGACAGCAGAGATCC-3')
  • 3′ sequencing primer WPRE-R (5'CATAGCGTAAAAGGAGCAACA-3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The linker region between the two PCPs is CGTGCGGATCCGCTAGCCTCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage-ubc-nls-ha-tdPCP-gfp was a gift from Robert Singer (Addgene plasmid # 40650 ; ; RRID:Addgene_40650)
  • For your References section:

    Fluorescence fluctuation spectroscopy enables quantitative imaging of single mRNAs in living cells. Wu B, Chao JA, Singer RH. Biophys J. 2012 Jun 20;102(12):2936-44. Epub 2012 Jun 19. 10.1016/j.bpj.2012.05.017 PubMed 22735544