pLinker-AID-3xHA-DHFR-LoxP
(Plasmid
#86669)
-
Purposefor generation of AID strains using CRISPR tagging technology
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 86669-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 86669-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Vector typeExpression in Toxoplasma gondii
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLinker-AID-3xHA-HXGPRT 3'UTR
-
SpeciesToxoplasma gondii
-
Insert Size (bp)1263
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PxpXI (not destroyed)
- 5′ sequencing primer GGGCCCgctagcAAGGGCTCGGGCTCGACCCAGCTGATGGGCAGTGTCGAGCT
- 3′ sequencing primer GACCCTCGAGTAGAACTAGTGGATCCGAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 86669-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 86669-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLinker-AID-3xHA-DHFR-LoxP was a gift from David Sibley (Addgene plasmid # 86669 ; http://n2t.net/addgene:86669 ; RRID:Addgene_86669) -
For your References section:
Calmodulin-like proteins localized to the conoid regulate motility and cell invasion by Toxoplasma gondii. Long S, Brown KM, Drewry LL, Anthony B, Phan IQH, Sibley LD. PLoS Pathog. 2017 May 5;13(5):e1006379. doi: 10.1371/journal.ppat.1006379. PPATHOGENS-D-17-00427 [pii] PubMed 28475612