Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTUB1:OsTIR1-3FLAG, SAG1:CAT
(Plasmid #87258)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87258 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript SK(+)
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2925
  • Total vector size (bp) 9655
  • Vector type
    Toxoplasma expression
  • Selectable markers
    CAT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    TIR1
  • Species
    Synthetic; Oryza sativa
  • Insert Size (bp)
    1806
  • Mutation
    Codon optimized for Toxoplasma gondii expression
  • GenBank ID
    4335696
  • Promoter TgTUB1 2717 bp
  • Tag / Fusion Protein
    • 3FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cttgtgtgaagttcttgcgg
  • 3′ sequencing primer gataaaggacacaggggtct
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CAT
  • Alt name
    Chloramphenicol acetyltransferase
  • Alt name
    CmR
  • Species
    Synthetic
  • Insert Size (bp)
    663
  • Promoter TgSAG1 361 bp

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer cggttgtatgtcggtttcgc
  • 3′ sequencing primer tgtgtattgacccatgtggc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTUB1:OsTIR1-3FLAG, SAG1:CAT was a gift from David Sibley (Addgene plasmid # 87258 ; http://n2t.net/addgene:87258 ; RRID:Addgene_87258)
  • For your References section:

    Plasma Membrane Association by N-Acylation Governs PKG Function in Toxoplasma gondii. Brown KM, Long S, Sibley LD. MBio. 2017 May 2;8(3). pii: e00375-17. doi: 10.1128/mBio.00375-17. 10.1128/mBio.00375-17 PubMed 28465425