pLinker-AID-3xHA-DHFR-LoxP
(Plasmid
#86669)
-
Purposefor generation of AID strains using CRISPR tagging technology
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeExpression in Toxoplasma gondii
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLinker-AID-3xHA-HXGPRT 3'UTR
-
SpeciesToxoplasma gondii
-
Insert Size (bp)1263
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PxpXI (not destroyed)
- 5′ sequencing primer GGGCCCgctagcAAGGGCTCGGGCTCGACCCAGCTGATGGGCAGTGTCGAGCT
- 3′ sequencing primer GACCCTCGAGTAGAACTAGTGGATCCGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLinker-AID-3xHA-DHFR-LoxP was a gift from David Sibley (Addgene plasmid # 86669 ; http://n2t.net/addgene:86669 ; RRID:Addgene_86669) -
For your References section:
Calmodulin-like proteins localized to the conoid regulate motility and cell invasion by Toxoplasma gondii. Long S, Brown KM, Drewry LL, Anthony B, Phan IQH, Sibley LD. PLoS Pathog. 2017 May 5;13(5):e1006379. doi: 10.1371/journal.ppat.1006379. PPATHOGENS-D-17-00427 [pii] PubMed 28475612