FLS2-YFPc
(Plasmid
#87166)
-
Purposefluorescence complementation assay
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87166-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87166-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAMPAT-35S
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFLS2
-
Alt nameFLAGELLIN-SENSITIVE 2
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneFLS2 (a.k.a. AT5G46330, FLAGELLIN-SENSITIVE 2, MPL12.13, MPL12.8, MPL12_13)
- Promoter 35s
-
Tag
/ Fusion Protein
- YFPc (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGACGCACAATCCCACTATCCTTCGCA
- 3′ sequencing primer CATTTGGAGAAGGACCTCGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 87166-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87166-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLS2-YFPc was a gift from Silke Robatzek (Addgene plasmid # 87166 ; http://n2t.net/addgene:87166 ; RRID:Addgene_87166) -
For your References section:
Plasma membrane calcium ATPases are important components of receptor-mediated signaling in plant immune responses and development. Frei dit Frey N, Mbengue M, Kwaaitaal M, Nitsch L, Altenbach D, Haweker H, Lozano-Duran R, Njo MF, Beeckman T, Huettel B, Borst JW, Panstruga R, Robatzek S. Plant Physiol. 2012 Jun;159(2):798-809. doi: 10.1104/pp.111.192575. Epub 2012 Apr 25. 10.1104/pp.111.192575 PubMed 22535420