Skip to main content

AtFLS2pro::GUS
(Plasmid #87167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87167 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 87167-D50 50 μg of DNA in Tris buffer $495
DNA 87167-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAMBIA2300
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AT5G46330 promoter
  • Alt name
    FLAGELLIN-SENSITIVE 2
  • Species
    A. thaliana (mustard weed)
  • Promoter AtFLS2
  • Tag / Fusion Protein
    • GUS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer ttcatctttattttaaaatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AtFLS2pro::GUS was a gift from Silke Robatzek (Addgene plasmid # 87167 ; http://n2t.net/addgene:87167 ; RRID:Addgene_87167)
  • For your References section:

    Expression patterns of flagellin sensing 2 map to bacterial entry sites in plant shoots and roots. Beck M, Wyrsch I, Strutt J, Wimalasekera R, Webb A, Boller T, Robatzek S. J Exp Bot. 2014 Dec;65(22):6487-98. doi: 10.1093/jxb/eru366. Epub 2014 Sep 9. 10.1093/jxb/eru366 PubMed 25205577