AtFLS2pro::GUS
(Plasmid
#87167)
-
Purposeexpression pattern of AtFLS2
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87167-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87167-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAMBIA2300
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAT5G46330 promoter
-
Alt nameFLAGELLIN-SENSITIVE 2
-
SpeciesA. thaliana (mustard weed)
- Promoter AtFLS2
-
Tag
/ Fusion Protein
- GUS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer ttcatctttattttaaaatc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 87167-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87167-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AtFLS2pro::GUS was a gift from Silke Robatzek (Addgene plasmid # 87167 ; http://n2t.net/addgene:87167 ; RRID:Addgene_87167) -
For your References section:
Expression patterns of flagellin sensing 2 map to bacterial entry sites in plant shoots and roots. Beck M, Wyrsch I, Strutt J, Wimalasekera R, Webb A, Boller T, Robatzek S. J Exp Bot. 2014 Dec;65(22):6487-98. doi: 10.1093/jxb/eru366. Epub 2014 Sep 9. 10.1093/jxb/eru366 PubMed 25205577
