px330-MRPsg1
(Plasmid
#87189)
-
Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 1
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC ori vector
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MRP RNA CRISPR guide #1
-
gRNA/shRNA sequenceGAGGACGTGGTTCGTGCTGA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneRMRP (a.k.a. CHH, NME1, RMRPR, RRP2)
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer CGTAAGTTATGTAACGGGTACCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330-MRPsg1 was a gift from Thomas Cech (Addgene plasmid # 87189 ; http://n2t.net/addgene:87189 ; RRID:Addgene_87189) -
For your References section:
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Goldfarb KC, Cech TR. Genes Dev. 2017 Jan 1;31(1):59-71. doi: 10.1101/gad.286963.116. Epub 2017 Jan 23. 10.1101/gad.286963.116 PubMed 28115465