Skip to main content

p426_Cas9_gRNA-HIS3b
(Plasmid #87402)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87402 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    p426
  • Vector type
    CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
  • gRNA/shRNA sequence
    AATATAGAGTGTACTAGAGG
  • Species
    S. cerevisiae (budding yeast)
  • Promoter ADH1, pTyrosine

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid has been found to exist as a dimer in our stock. Plasmid dimerization often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426_Cas9_gRNA-HIS3b was a gift from Aindrila Mukhopadhyay (Addgene plasmid # 87402 ; http://n2t.net/addgene:87402 ; RRID:Addgene_87402)
  • For your References section:

    A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Reider Apel A, d'Espaux L, Wehrs M, Sachs D, Li RA, Tong GJ, Garber M, Nnadi O, Zhuang W, Hillson NJ, Keasling JD, Mukhopadhyay A. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. 10.1093/nar/gkw1023 PubMed 27899650