p426_Cas9_gRNA-ARS1309a
(Plasmid #87399)

• Purpose: All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.
• Depositing Lab: Aindrila Mukhopadhyay
• Publication: Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.

Backbone

• Vector backbone: p426
• Vector type: CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
• gRNA/shRNA sequence: CCTGTGGTGACTACGTATCC
• Species: S. cerevisiae (budding yeast)
• Promoter: ADH1, pTyrosine

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has been found to exist as both a monomer and a dimer in our stock. Plasmid dimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.