Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCZGY2838
(Plasmid #87759)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87759 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Gateway Final LR Clone
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 6975
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pmyo-3-PH-miniSOG
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    4000
  • Promoter Pmyo-3
  • Tag / Fusion Protein
    • PH

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgtaaaacgacggccagt
  • 3′ sequencing primer caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2838 was a gift from Andrew Chisholm (Addgene plasmid # 87759 ; http://n2t.net/addgene:87759 ; RRID:Addgene_87759)
  • For your References section:

    Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG. Xu S, Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271. 10.1038/srep21271 PubMed 26861262