pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
(Plasmid
#87917)
-
PurposeGateway cloning
-
Depositing Lab
-
Depositing OrganizationCentre Hospitalier Universitaire Vaudois (CHUV)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87917-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87917-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepENTR221
-
Backbone manufacturerThermofisher
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 3688
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgHTT1, sgGFP2, shCas9
-
Alt namesgRNA
-
SpeciesSynthetic
-
Insert Size (bp)1093
- Promoter H1, U6, 7SK
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 87917-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87917-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9 was a gift from Nicole Déglon (Addgene plasmid # 87917 ; http://n2t.net/addgene:87917 ; RRID:Addgene_87917) -
For your References section:
The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690