Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SIN-CMV-Cas9-V5-WPRE
(Plasmid #87904)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87904 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HIV-1 SIN lentiviral transfer vector
  • Backbone size w/o insert (bp) 7600
  • Total vector size (bp) 13258
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-V5
  • Alt name
    Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4230
  • Mutation
    human codon-optimized
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAGGCGTGTACGGTGGGAGGC
  • 3′ sequencing primer AGCAGCGTATCCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hCas9 from Addgene plasmid #41815
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SIN-CMV-Cas9-V5-WPRE was a gift from Nicole Déglon (Addgene plasmid # 87904 ; http://n2t.net/addgene:87904 ; RRID:Addgene_87904)
  • For your References section:

    The self-inactivating KamiCas9 system for the editing of CNS disease genes. Merienne, Nicolas, Gabriel Vachey, Lucie de Longprez, Cécile Meunier, Virginie Zimmer, Guillaume Perriard, Mathieu Canales, Amandine Mathias, Lucas Herrgott, Tim Beltraminelli, Axelle Maulet, Thomas Dequesne, Catherine Pythoud, Maria Rey, Luc Pellerin, Emmanuel Brouillet, Anselme L. Perrier, Renaud du Pasquier, and Nicole Déglon. Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 10.1016/j.celrep.2017.08.075