SIN-CMV-Cas9-V5-WPRE
(Plasmid
#87904)
-
PurposeTo produce lentiviral vector for gene editing
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneHIV-1 SIN lentiviral transfer vector
- Backbone size w/o insert (bp) 7600
- Total vector size (bp) 13258
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-V5
-
Alt nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4230
-
Mutationhuman codon-optimized
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAGGCGTGTACGGTGGGAGGC
- 3′ sequencing primer AGCAGCGTATCCACATAGCGTAAAAGGAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9 from Addgene plasmid #41815
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SIN-CMV-Cas9-V5-WPRE was a gift from Nicole Déglon (Addgene plasmid # 87904 ; http://n2t.net/addgene:87904 ; RRID:Addgene_87904) -
For your References section:
The self-inactivating KamiCas9 system for the editing of CNS disease genes. Merienne, Nicolas, Gabriel Vachey, Lucie de Longprez, Cécile Meunier, Virginie Zimmer, Guillaume Perriard, Mathieu Canales, Amandine Mathias, Lucas Herrgott, Tim Beltraminelli, Axelle Maulet, Thomas Dequesne, Catherine Pythoud, Maria Rey, Luc Pellerin, Emmanuel Brouillet, Anselme L. Perrier, Renaud du Pasquier, and Nicole Déglon. Cell Reports , Volume 20 , Issue 12 , 2980 - 2991 10.1016/j.celrep.2017.08.075