Skip to main content
Addgene
Open Menu

PGC-1 alpha promoter luciferase delta MEF
(Plasmid #8889)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8889 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 8889-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 8889-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PGC-1 alpha promoter dMEF
  • Alt name
    PGC1 promoter
  • Alt name
    PGC-1a promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2600
  • Mutation
    Site-directed mutagenesis to remove the MEF2 binding site.
  • Entrez Gene
    Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
  • 3′ sequencing primer GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the MEF site between -1464 and -1447 from CTAAATATAA to CTCCGCGGAA.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGC-1 alpha promoter luciferase delta MEF was a gift from Bruce Spiegelman (Addgene plasmid # 8889 ; http://n2t.net/addgene:8889 ; RRID:Addgene_8889)

  • For your References section:

    An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM. Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. 10.1073/pnas.1232352100 PubMed 12764228
Related items:
Commonly requested with: