-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePGC-1 alpha promoter dCRE
-
Alt namePGC1 promoter
-
Alt namePGC-1a promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2600
-
MutationSite-directed mutagenesis to remove the CREB binding site.
-
Entrez GenePpargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
-
Tag
/ Fusion Protein
- luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
- 3′ sequencing primer GLprimer2 (CTTTATGTTTTTGGCGTCTTCCA) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' flanking sequence of mouse PGC-1 alpha gene PCR amplified between +78 and -2533 with respect to the transcriptional start site. Mutation of the CRE site between -146 and -129 from TGACGTCA to TAGATCTA.
NOTE: The full sequence from the depositor is theoretical. There are several discrepancies between Addgene's quality control sequence and the full sequence provided here, but those discrepancies do not appear to affect function. Several labs have published successfully with this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGC-1 alpha promoter luciferase delta CRE was a gift from Bruce Spiegelman (Addgene plasmid # 8888 ; http://n2t.net/addgene:8888 ; RRID:Addgene_8888) -
For your References section:
An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM. Proc Natl Acad Sci U S A. 2003 Jun 10. 100(12):7111-6. 10.1073/pnas.1232352100 PubMed 12764228