pTH859-gst-optec Y172M
(Plasmid #89593)

• Purpose: Plasmid for bacterial expression of a His-tagged Y172M mutant of GST encoded by preferred codons
• Depositing Lab: Tobias von der Haar
• Publication: Jossé et al bioRxiv 200006

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5240
• Total vector size (bp): 5935
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: glutathione-S transferase Y172M mutant, codon-optimised for bacterial expression
• Species: synthetic construct
• Insert Size (bp): 695
• Mutation: changed tyrosine 172 to methionine
• GenBank ID: LT799420.1
• Promoter: T7
• Tag / Fusion Protein:
  • 8xhistidine (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GGCGCCAGCAACCGCACCTGTGGC
• 3′ sequencing primer: GCGCCGCTACAGGGCGCGTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry