pMT2 Beta1b GFP
(Plasmid
#89893)
-
PurposeMammalian expression of Beta1b GFP
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89893-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89893-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMT2
- Backbone size w/o insert (bp) 5129
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCacnb1
-
Alt nameBeta1b
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2662
-
MutationGFP sequence inserted just before the Stop codon
-
Entrez GeneCacnb1 (a.k.a. CAB1)
- Promoter adenovirus major late promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5' agcttgaggtgtggcaggctt 3'
- 3′ sequencing primer 5' ggtcgaaccatgatggcagc 3'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89893-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89893-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT2 Beta1b GFP was a gift from Annette Dolphin (Addgene plasmid # 89893 ; http://n2t.net/addgene:89893 ; RRID:Addgene_89893) -
For your References section:
The CaVbeta Subunit Protects the I-II Loop of the Voltage-gated Calcium Channel CaV2.2 from Proteasomal Degradation but Not Oligoubiquitination. Page KM, Rothwell SW, Dolphin AC. J Biol Chem. 2016 Sep 23;291(39):20402-16. doi: 10.1074/jbc.M116.737270. Epub 2016 Aug 3. 10.1074/jbc.M116.737270 PubMed 27489103