GFP-ataxin-3 C-t
(Plasmid
#89981)
-
PurposeExpresses the GFP-tagged C-terminus of ataxin-3
-
Depositing Lab
-
Depositing OrganizationKarolinska Institutet
Located in Sweden -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89981-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89981-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameataxin-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)540
-
Mutationdeleted amino acids 1-182
-
Entrez GeneATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTG
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89981-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89981-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-ataxin-3 C-t was a gift from Nico Dantuma (Addgene plasmid # 89981 ; http://n2t.net/addgene:89981 ; RRID:Addgene_89981) -
For your References section:
Ataxin-3 consolidates the MDC1-dependent DNA double-strand break response by counteracting the SUMO-targeted ubiquitin ligase RNF4. Pfeiffer A, Luijsterburg MS, Acs K, Wiegant WW, Helfricht A, Herzog LK, Minoia M, Bottcher C, Salomons FA, van Attikum H, Dantuma NP. EMBO J. 2017 Mar 8. pii: e201695151. doi: 10.15252/embj.201695151. 10.15252/embj.201695151 PubMed 28275011