GFP-ataxin-3
(Plasmid
#89975)
-
PurposeExpresses GFP-tagged ataxin-3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameataxin-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1086
-
GenBank IDNM_004993.5
-
Entrez GeneATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTG
- 3′ sequencing primer TTTAAAGCAAGTAAAACCTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-ataxin-3 was a gift from Nico Dantuma (Addgene plasmid # 89975 ; http://n2t.net/addgene:89975 ; RRID:Addgene_89975) -
For your References section:
Ataxin-3 consolidates the MDC1-dependent DNA double-strand break response by counteracting the SUMO-targeted ubiquitin ligase RNF4. Pfeiffer A, Luijsterburg MS, Acs K, Wiegant WW, Helfricht A, Herzog LK, Minoia M, Bottcher C, Salomons FA, van Attikum H, Dantuma NP. EMBO J. 2017 Mar 8. pii: e201695151. doi: 10.15252/embj.201695151. 10.15252/embj.201695151 PubMed 28275011