Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-ataxin-3 N-t
(Plasmid #89980)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89980 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ataxin-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    546
  • Mutation
    construct contains aa 1-182; deleted aa 183-361
  • Entrez Gene
    ATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-ataxin-3 N-t was a gift from Nico Dantuma (Addgene plasmid # 89980 ; http://n2t.net/addgene:89980 ; RRID:Addgene_89980)
  • For your References section:

    Ataxin-3 consolidates the MDC1-dependent DNA double-strand break response by counteracting the SUMO-targeted ubiquitin ligase RNF4. Pfeiffer A, Luijsterburg MS, Acs K, Wiegant WW, Helfricht A, Herzog LK, Minoia M, Bottcher C, Salomons FA, van Attikum H, Dantuma NP. EMBO J. 2017 Mar 8. pii: e201695151. doi: 10.15252/embj.201695151. 10.15252/embj.201695151 PubMed 28275011