LP377
(Plasmid #90201)

• Purpose: pCMV-myc with cDNA encoding HsTRAPPC11 aa residues 701-1133
• Depositing Lab: Lotte Pedersen
• Publication: Schou et al Cilia. 2014 Jun 18;3:6. doi: 10.1186/2046-2530-3-6. eCollection 2014.

Backbone

• Vector backbone: pCMV-Myc
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 5096
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TRAPPC11
• Species: H. sapiens (human)
• Insert Size (bp): 1296
• Mutation: aa residues 701-1133
• GenBank ID: NP_068761.4
• Entrez Gene: TRAPPC11 (a.k.a. C4orf41, FOIGR, GRY, LGMD2S, LGMDR18)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CMV-F: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: SV40pA-R: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry