-
PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4
-
Depositing Labs
-
Depositing OrganizationDana-Farber Cancer Institute
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330A
- Backbone size w/o insert (bp) 4850
- Total vector size (bp) 8951
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
gRNA/shRNA sequenceATGTCTGCGGAGAGCGGCCC (BRD4), gcatcgtacgcgtacgtgtt (PITCH)
-
SpeciesSynthetic
- Promoter chicken β-actin promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gccttttgctggccttttgctc
- 3′ sequencing primer cgggccatttaccgtaagttatgtaacg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See:
Sakuma, T., Nakade, S., Sakane, Y., Suzuki, K.-I. & Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc 11, 118–133 (2016).
for the original backbone and general cloning protocol.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330A-nBRD4/PITCh was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91794 ; http://n2t.net/addgene:91794 ; RRID:Addgene_91794) -
For your References section:
The dTAG system for immediate and target-specific protein degradation. Nabet B, Roberts JM, Buckley DL, Paulk J, Dastjerdi S, Yang A, Leggett AL, Erb MA, Lawlor MA, Souza A, Scott TG, Vittori S, Perry JA, Qi J, Winter GE, Wong KK, Gray NS, Bradner JE. Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26. 10.1038/s41589-018-0021-8 PubMed 29581585