Skip to main content
Addgene
Open Menu

c-myc-PT3EF1a
(Plasmid #92046)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92046 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 92046-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 92046-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pT3-EF1a
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    C-MYC
  • Alt name
    MYC
  • Species
    H. sapiens (human)
  • GenBank ID
    P01106.1
  • Entrez Gene
    MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
  • Promoter EF-1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GAGTTTGGATCTTGGTTCATTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is in the OPEN state: there is no stop codon on c-myc.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c-myc-PT3EF1a was a gift from Xin Chen (Addgene plasmid # 92046 ; http://n2t.net/addgene:92046 ; RRID:Addgene_92046)

  • For your References section:

    A functional mTORC1 signaling is indispensable for c-Myc driven hepatocarcinogenesis. Liu P, Ge M, Hu J, Li X, Che L, Sun K, Cheng L, Huang Y, Pilo MG, Cigliano A, Pes GM, Pascale RM, Brozzetti S, Vidili G, Porcu A, Cossu A, Palmieri G, Sini MC, Ribback S, Dombrowski F, Tao J, Calvisi DF, Chen L, Chen X. Hepatology. 2017 Mar 30. doi: 10.1002/hep.29183. 10.1002/hep.29183 PubMed 28370287
Related items:
Commonly requested with: