Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #34879)


Item Catalog # Description Quantity Price (USD)
Plasmid 34879 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    SB100X transposase
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Dr. Zsuzsanna Izsvak, Max-Delbrueck-Center for Molecular Medicine, Berlin
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

The Sleeping Beauty transposon system consists of two components: the transposon vector and the transposase vector. The transposon vector (pT4/HB, Addgene #108352) contains binding sites flanking the GOI. And the transposase vector (pCMV(CAT)T7-SB100, Addgene #34879) encodes for the enzyme mediating excision and integration of the GOI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879 ; ; RRID:Addgene_34879)
  • For your References section:

    Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Mates L, Chuah MK, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, Grzela DP, Schmitt A, Becker K, Matrai J, Ma L, Samara-Kuko E, Gysemans C, Pryputniewicz D, Miskey C, Fletcher B, VandenDriessche T, Ivics Z, Izsvak Z. Nat Genet. 2009 Jun;41(6):753-61. Epub 2009 May 3. 10.1038/ng.343 PubMed 19412179