-
PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.
-
Depositing Lab
-
Depositing OrganizationDanmarks Tekniske Universitet
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92053-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92053-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMAZ-SK
- Total vector size (bp) 7403
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
- Promoter ptet
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAAGTCTGGTTATAACC
- 3′ sequencing primer TACCGGTTTATTGACTACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA array
-
SpeciesSynthetic
- Promoter pRhamBAD
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gccacaattcagcaaattgtgaac
- 3′ sequencing primer GTGCCGATATCTAAGCCTATTGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 92053-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92053-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFREE_Zeo was a gift from Morten Norholm (Addgene plasmid # 92053 ; http://n2t.net/addgene:92053 ; RRID:Addgene_92053) -
For your References section:
A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Lauritsen I, Porse A, Sommer MOA, Norholm MHH. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. 10.1186/s12934-017-0748-z [pii] PubMed 28764701