pCAG MCP-VP64
(Plasmid #92357)

• Purpose: CAG-driven ubiquitous expression of MCP-VP64. MCP is bacteriophage MS2 coat protein, VP64 is transcriptional activation domain. Part of SAM-mediated gene activation system in chicken embryos.
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Williams et al Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4911
• Total vector size (bp): 5541
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCP-VP64
• Insert Size (bp): 630
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTGCTGGTTATTGTGCTGT
• 3′ sequencing primer: GTCTCTCACTCGGAAGGACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: MCP and VP64 fragments amplified from Addgene #61423 and #47319, respectively

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.