pTK Cas9-2A-Citrine
(Plasmid
#92393)
-
PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92393-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92393-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTK
- Backbone size w/o insert (bp) 4157
- Total vector size (bp) 9101
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 2A Citrine
-
SpeciesS. pyogenes
-
Insert Size (bp)4944
- Promoter thymidine kinase promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cctgcggctgatctatctgg
- 3′ sequencing primer attcacttggggcatgctca
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTK EGFP was made by Uchikawa et al 2003, by insertion of the Herpes simplex virus thymidine kinase promoter in the polylinker HindIII site of pCAT3-basic vector (Promega), and by replacing the CAT gene with the EGFP gene (Clontech). We have modified this vector by inserting BsmBI flanked lacZ MCS cassette and replaced EGFP with Citrine. Subsequently we amplified Cas9 from #42230 and inserted this followed by a 2A sequence into the NcoI site in the modified pTK citrine vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718
Functional analysis of chicken Sox2 enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Uchikawa M1, Ishida Y, Takemoto T, Kamachi Y, Kondoh H. Dev Cell. 2003 Apr;4(4):509-19.
Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.
DNA (Catalog # 92393-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92393-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTK Cas9-2A-Citrine was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92393 ; http://n2t.net/addgene:92393 ; RRID:Addgene_92393) -
For your References section:
Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245