Skip to main content

[GG][Pin]
(Plasmid #97191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97191 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 97191-D50 50 μg of DNA in Tris buffer $495
DNA 97191-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    mutated to remove BsaI
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pin domain
  • Alt name
    SMG6 Isoform 1 (Uniprot identifier: Q86US8-1)
  • Insert Size (bp)
    546
  • Promoter CMV
  • Tag / Fusion Protein
    • Pum cloning site (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer GTATCTTATCATGTCTGCTCGAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

[GG] is a Golden Gate cloning site, a BsaI enzyme restriction site with sticky ends CGAG___ACGC, as described in the cloning scheme of Figure S1. The Pin domain silencing experiment is shown in Figure S4.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    [GG][Pin] was a gift from Edward Boyden (Addgene plasmid # 97191 ; http://n2t.net/addgene:97191 ; RRID:Addgene_97191)
  • For your References section:

    Programmable RNA-binding protein composed of repeats of a single modular unit. Adamala KP, Martin-Alarcon DA, Boyden ES. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26. 10.1073/pnas.1519368113 PubMed 27118836