[UBC][EIF4e][GG cloning]
(Plasmid
#97189)
-
PurposeEIF4e plasmid with Pum cloning site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
-
Modifications to backbonemutated to remove BsaI, original promoter replaced with UBC promoter
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEIF4E variant 1
-
Alt nameAUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)651
-
GenBank IDNM_001968
-
Entrez GeneEIF4E (a.k.a. AUTS19, CBP, EIF4E1, EIF4EL1, EIF4F, eIF-4E)
- Promoter UBC (ubiquitin C)
-
Tag
/ Fusion Protein
- empty Pum cloning site (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GTATCTTATCATGTCTGCTCGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Experiments using this plasmid are shown in Figure 6 of our paper.
[GG] is a Golden Gate cloning site, a BsaI enzyme restriction site with sticky ends CGAG___ACGC, as described in cloning scheme in Figure S1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
[UBC][EIF4e][GG cloning] was a gift from Edward Boyden (Addgene plasmid # 97189 ; http://n2t.net/addgene:97189 ; RRID:Addgene_97189) -
For your References section:
Programmable RNA-binding protein composed of repeats of a single modular unit. Adamala KP, Martin-Alarcon DA, Boyden ES. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26. 10.1073/pnas.1519368113 PubMed 27118836