AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
(Plasmid
#97311)
-
PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActb MMEJ donor
-
Alt nameActb MMEJ template
-
gRNA/shRNA sequenceagtccgcctagaagcacttg
-
SpeciesSynthetic
-
Insert Size (bp)879
- Promoter U6, EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA was a gift from Hui Yang (Addgene plasmid # 97311 ; http://n2t.net/addgene:97311 ; RRID:Addgene_97311) -
For your References section:
Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, Shen X, Wei Y, Huang Z, Ying W, Wang Y, Nie YH, Zhang CC, Li S, Cheng L, Wang Q, Wu Y, Huang P, Sun Q, Shi L, Yang H. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. 10.1038/cr.2017.76 PubMed 28524166