Skip to main content

pluc2-iRFP720
(Plasmid #98887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98887 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 98887-D50 50 μg of DNA in Tris buffer $495
DNA 98887-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTurbo
  • Backbone manufacturer
    Evrogen
  • Total vector size (bp) 6565
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Alt name
    Luc2
  • Species
    Photinus Pyralis
  • Insert Size (bp)
    1641
  • Promoter CMV
  • Tag / Fusion Protein
    • iRFP720 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer gctagcaatggaagatgccaaaaac
  • 3′ sequencing primer gtcgactgcttgccgcccttcttggcct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pluc2-iRFP720 was a gift from Laura Mezzanotte (Addgene plasmid # 98887 ; http://n2t.net/addgene:98887 ; RRID:Addgene_98887)
  • For your References section:

    Optimized longitudinal monitoring of stem cell grafts in mouse brain using a novel bioluminescent/near infrared fluorescent fusion reporter. Mezzanotte L, Iljas JD, Que I, Chan A, Kaijzel E, Hoeben R, Lowik C. Cell Transplant. 2017 Apr 26. doi: 10.3727/096368917X695407. 10.3727/096368917X695407 PubMed 28447574