pluc2-iRFP720
(Plasmid
#98887)
-
PurposeMammalian expression
-
Depositing Lab
-
Depositing OrganizationErasmus Medical Center
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 98887-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 98887-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTurbo
-
Backbone manufacturerEvrogen
- Total vector size (bp) 6565
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameLuc2
-
SpeciesPhotinus Pyralis
-
Insert Size (bp)1641
- Promoter CMV
-
Tag
/ Fusion Protein
- iRFP720 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer gctagcaatggaagatgccaaaaac
- 3′ sequencing primer gtcgactgcttgccgcccttcttggcct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 98887-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 98887-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pluc2-iRFP720 was a gift from Laura Mezzanotte (Addgene plasmid # 98887 ; http://n2t.net/addgene:98887 ; RRID:Addgene_98887) -
For your References section:
Optimized longitudinal monitoring of stem cell grafts in mouse brain using a novel bioluminescent/near infrared fluorescent fusion reporter. Mezzanotte L, Iljas JD, Que I, Chan A, Kaijzel E, Hoeben R, Lowik C. Cell Transplant. 2017 Apr 26. doi: 10.3727/096368917X695407. 10.3727/096368917X695407 PubMed 28447574
Map uploaded by the depositor.
