pMVS102_P3-GFP-NATMX6
(Plasmid #99048)

• Purpose: EGFP reporter with six binding sites for the Zif268 DNA binding domain
• Depositing Lab: Barak Cohen
• Publication: Staller et al Cell Syst. 2018 Mar 1. pii: S2405-4712(18)30052-8. doi: 10.1016/j.cels.2018.01.015.

Backbone

• Vector backbone: pFA6
• Backbone size w/o insert (bp): 3436
• Total vector size (bp): 7072
• Modifications to backbone: digested with BamHI and AscI
• Vector type: Yeast Expression
• Selectable markers: cloneNAT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: McIsaac 2014 P3 promoter
• Alt name: Modified GAL1 promoter with 6 Zif268 binding sites
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 653
• Mutation: GAL1 promoter with 4 GAL4 sites removed and replaced with Zif268 sites

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: SP6

Gene/Insert 2

• Gene/Insert name: eGFP
• Species: Aequorea victoria
• Insert Size (bp): 717
• Promoter: McIsaac 2014 P3 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aTGTCTAAAGGTGAAGAATTATTCA
• 3′ sequencing primer: ggacgaggcaagctaaacag

Gene/Insert 3

• Gene/Insert name: clonNAT resistance
• Insert Size (bp): 573

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: ctgtttagcttgcctcgtcc
• 3′ sequencing primer: T7

Resource Information

• Supplemental Documents:
  • pMVS102_P3-GFP-NATMX6.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The P3 promoter sequence is from McIsaac, R. S., Gibney, P. A., Chandran, S. S., Benjamin, K. R., & Botstein, D. (2014). Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), e48. http://doi.org/10.1093/nar/gkt1402