pMVS102_P3-GFP-NATMX6
(Plasmid
#99048)
-
PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFA6
- Backbone size w/o insert (bp) 3436
- Total vector size (bp) 7072
-
Modifications to backbonedigested with BamHI and AscI
-
Vector typeYeast Expression
-
Selectable markerscloneNAT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMcIsaac 2014 P3 promoter
-
Alt nameModified GAL1 promoter with 6 Zif268 binding sites
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)653
-
MutationGAL1 promoter with 4 GAL4 sites removed and replaced with Zif268 sites
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)717
- Promoter McIsaac 2014 P3 promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aTGTCTAAAGGTGAAGAATTATTCA
- 3′ sequencing primer ggacgaggcaagctaaacag
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameclonNAT resistance
-
Insert Size (bp)573
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ctgtttagcttgcctcgtcc
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The P3 promoter sequence is from McIsaac, R. S., Gibney, P. A., Chandran, S. S., Benjamin, K. R., & Botstein, D. (2014). Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), e48. http://doi.org/10.1093/nar/gkt1402
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVS102_P3-GFP-NATMX6 was a gift from Barak Cohen (Addgene plasmid # 99048 ; http://n2t.net/addgene:99048 ; RRID:Addgene_99048) -
For your References section:
A High-Throughput Mutational Scan of an Intrinsically Disordered Acidic Transcriptional Activation Domain. Staller MV, Holehouse AS, Swain-Lenz D, Das RK, Pappu RV, Cohen BA. Cell Syst. 2018 Mar 1. pii: S2405-4712(18)30052-8. doi: 10.1016/j.cels.2018.01.015. 10.1016/j.cels.2018.01.015 PubMed 29525204