pHES795
(Plasmid
#87943)
-
PurposeConstitutively expresses estradiol-inducible synthetic transcription factor in yeast. It activates transcription of promoters containing Zif268 binding sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAD606
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 9173
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZif268 DBD - hER LBD - MSN2 AD
-
Alt nameZEM
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)2173
-
Entrez GeneESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
- Promoter ADH1 (crippled)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PspOMI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer GTGGATTCGGCTTTGGGTA
- 3′ sequencing primer CGCACTCACGTAAACACTTAATC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHES795 was a gift from Hana El-Samad (Addgene plasmid # 87943 ; http://n2t.net/addgene:87943 ; RRID:Addgene_87943) -
For your References section:
Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885