Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pHES841
(Plasmid #89194)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89194 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNH604
  • Backbone size w/o insert (bp) 7294
  • Total vector size (bp) 8716
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pZ-YFP
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Promoter pZ

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PspOMI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TATTAGCTTGTGCATTCGCAT
  • 3′ sequencing primer CGCACTCACGTAAACACTTAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHES841 was a gift from Hana El-Samad (Addgene plasmid # 89194 ; http://n2t.net/addgene:89194 ; RRID:Addgene_89194)
  • For your References section:

    Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885